sábado, 22 de agosto de 2009

Jardinera con palets (fabricación casera)

Aprovechando que aquí hizo un verano con muy mal tiempo decidí meterme en el trastero y sacarle partido a las maderas de unos palets. Había visto por la red que la gente hacía auténticas maravillas y decidí probar a construir una jardinera para mi chica mientras ella pasaba unos días en un congreso. Os dejo un pequeño reportaje gráfico del proceso:



Primero seleccionamos las maderas que están en mejor estado y las vamos puliendo con ese maravilloso invento de la humanidad que es la lijadora eléctrica :)



Aquí podemos apreciar la diferencia entre no lijar y lijar



A continuación le aplicamos un protector a la madera para evitar que se pudra



¡Listo! Todas las maderas preparadas



Ya he montado los conjuntos de tablas que van a formar los laterales y el fondo, sin embargo descubro un pequeño problema: las tablas que se usan para unir los tablones tienen que ser un poco más cortos para que encanjen bien todas las partes. ¡Toca serrar un poco más!



Antes de unir todo, le hago unas pequeñas patas al fondo para que soporte mejor el peso y quede a cierta altura del suelo.



Ahora si, le uno el primer lateral a golpe de tornillo.



El siguiente lateral se pone en un momentito.



Un detalle, en uno de los laterales con un cutter le he grabado unas letras que luego repasé con un lápiz. Es el nombre de nuestro huerto: Villa Tomato.



Cierro por uno de los lados, al cual le he añadido unos ángulos metálicos. Ahora veréis para qué lo he hecho.





Este es el aspecto que tiene el cajón una vez terminado el atornillamiento :)



Tanta madera junta era lógico que iba a pesar un poquito y ya no digamos cuando tenga la tierra dentro, así que aprovechando los angulos, le hice unas asas con cordones.



Ahora le aplico un poco de tinte "wenge" para que tenga un aspecto de madera antigua.





A las letras les voy dando una pequeña capa de pintura roja.



El siguiente paso es el barnizado. Un par de capas serán más que suficiente para estar protegido y brillante ;)



Una vez que se ha secado el barniz lo subimos a la terraza y con la broca más grande que tengo le hago una gran cantidad de agujeros para que después drene bien.



La última fase es recubrirlo por el interior con un plástico aislante. Una grapadora normal nos servirá para fijar el plástico a la madera.



Una vez terminado de poner el plástico lo colocamos en el que va a ser su sitio y en el fondo le echamos una capa de bolas de arcilla para mejorar el drenaje y mantener el nivel de humedad de la tierra.


Y aquí está terminado y con sus nuevos habitantes :)

6 comentarios:

Cris dijo...

Genial regalito de cumpleaños para Cris :*

ferprado dijo...

ya os veo saliendo en casa y hjardín, quedo muy chula nos pasaremos a verla en directo para que Claudia le saque la tierra que sobra jejeje

Aurora Cascudo dijo...

guaaaaaaaaaauuuuuuuuuu!

a-lu-ci-nan-te!!

el toquecillo de "villa tomato" con tanto cuidado...es la guinda de los tomates (que plato!)
;)

fabuloso el tutorial!

Cris dijo...

Hola, te dejo una cosita en mi blog :)

CHEMA dijo...

Q chuliiiii!!!

Sergio Sanchez Fernandez dijo...

Esta muy bien hecho, no se si de la humedad se te saldrán los tornillos, yo la estructura la hice de aluminio y lo demás de madera. por lo demás la veo perfecta